Induced Expression of BMP4 in WAT Produces a BAT-Like Phenotype.

To assess the effect of expressing BMP4 in adipocytes, transgenic (TG) mice were generated using the adipose tissue-specific fatty acid-binding protein 4 (Fabp4) promoter to drive the expression of BMP4 (Fig. S1A). As shown in Fig. 1C and Fig. S1B, BMP4 expression was increased in both WAT and BAT of the TG mice. Expression of BMP4 in the stromal vascular fraction (SVF) was not affected by the transgene (Fig. S1C). Although the Fabp4 promoter has been shown to be active in the brain (33), the BMP4 mRNA level was not elevated in brain by the transgene (Fig. S1D).There was no significant difference in BMP4 expression in muscle and liver tissue of TG relative to control mice (Fig. S1E). Thus, expression of BMP4 in the TG mice was limited to adipose tissue.

The amount of gonadal (visceral) WAT was reduced markedly by the BMP4 transgene in both male and female mice (Fig. 1 D and E; and Fig. S1F). However, the amount of inguinal (subcutaneous) WAT obviously remained unchanged (Fig. 1 D and ​and1E1E and Fig. S1F). Moreover, the inguinal WAT tissue acquired a reddish appearance characteristic of BAT (Fig. 1 D and F). The amount of interscapular BAT increased slightly (Fig. 1 D and E and Fig. S1F). The size of both inguinal and gonadal adipocytes was reduced in the BMP4 TG mice, and the cells lost their unilocular morphology and acquired a multilocular appearance (Fig. 1 F and G). These results indicated that the expression of a high level of BMP4 in WAT led to a BAT-like appearance. Furthermore, the expression of beige adipocyte markers or factors reported to be highly expressed in beige/brite adipocytes (14–16), i.e., CD137, transmembrane protein 26 (TMEM26), transcription factor T-box 1 (Tbx1), transcription factor T-box 15 (Tbx15), and homeo box C9 (Hoxc9), was examined. The mRNA levels of TMEM26 and CD137 did not increase significantly, but Tbx1, Tbx15, and Hoxc9 levels increased in the inguinal WAT of BMP4 TG mice (Fig. 1H).

Although the percentage of mature adipocytes relative to total cell number in the fat tissue mass in both WAT and BAT did not differ between the two types of mice (Fig. S1G), the number (based on DNA content) of inguinal white and brown adipocytes increased, whereas the number of gonadal white adipocytes remained unchanged (Fig. S1H). Thus, both inguinal WAT and BAT underwent BMP4-induced hyperplasia.

Induced Expression of BMP4 Leads to Increased Mitochondrial Biogenesis and Key BAT Gene Expression in WAT.

Because subcutaneous inguinal WAT of the BMP4 TG mice acquired the appearance of BAT, we investigated the possibility that mitochondrial biogenesis in WAT occurred. Immunohistochemical analysis showed more mitochondria staining immunopositive in both inguinal and gonadal WAT of TG mice (Fig. S2D). Transmission electron microscopy of inguinal WAT revealed a marked increase in the number and size of mitochondria (Fig. 2 A–C). Although the diameters of mitochondrial organelles in gonadal WAT did not change significantly, the number did increase (Fig. 2 A–C).

Open in a separate window

Fig. 2.

Increased mitochondrial biogenesis of WAT in Fabp4-BMP4 TG mice. (A) Transmission electron microscopy showing mitochondrial morphology of WAT and BAT from WT and Fabp4-BMP4 TG mice. (Scale bar: 500 nm.) (B) Mitochondrial number per nucleus was determined from electron micrographs of 20 cells from each type of adipose tissue. (C) Mitochondria (120–150) were randomly selected, and mitochondrial diameter was determined with a ruler. (D) qRT-PCR data showing the fold induction of the expression of indicated genes normalized to the housekeeping gene 18S in inguinal WAT of WT and TG mice (n = 4–6). (E) qRT-PCR data showing the fold induction of the expression of the indicated genes normalized to the housekeeping gene 18S in gonadal WAT of WT and TG mice (n = 4–7). (F) qRT-PCR data showing the fold induction of the expression of the indicated genes normalized to the housekeeping gene 18S in BAT of WT and TG mice (n = 4–7). (G) Arrest of postconfluent growth. 3T3-L1 preadipocytes were induced to differentiate by treatment with monocyte differentiation-inducing factors (MDI) with or without 20 ng/mL BMP4. Adipocytes differentiated from 3T3-L1 adipocytes at day 8 after MDI induction are stained with Oil Red O. (H) Western blot analysis of lysates (30 μg) differentiated from 3T3-L1 adipocytes at day 6 after MDI induction with or without 20 ng/mL BMP4. (I) qRT-PCR of differentiated 3T3-L1 adipocytes for expression of indicated genes at day 6 after MDI induction with or without 20 ng/mL BMP4. Data from 2-mo-old mice on a normal chow diet are expressed as means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.

PGC1α and PR domain containing 16 (PRDM16) are regarded as key inducers of brown adipocyte development (34–37). Real-time PCR analysis revealed that levels of PGC1α and uncoupling protein 1 (UCP1) (a target gene of PGC1α) were increased approximately ninefold and approximately 7.5-fold, respectively, whereas PRDM16 was increased approximately sixfold in inguinal WAT of BMP4 TG mice (Fig. 2D). Consistent with these changes, the levels of the mRNAs encoding mitochondrial cytochrome C (Cycs), mitochondrial transcription factor A (mtTFA), carnitine palmitoyl-CoA:transferase 1B (CPT1b), and medium-chain acyl-CoA dehydrogenase (MCAD) were elevated in BMP4 TG mice (Fig. 2D). Except for UCP-1, the expression of these brown adipocyte developmental- and mitochondrial-related genes also was increased in gonadal WAT (Fig. 2E). In BAT, however, the expression of these genes decreased in BMP4 TG mice (Fig. 2F), as did mitochondrial size. However, the number of mitochondria did not change (based on electron microscopic measurements; Fig. 2 B and C), and fewer mitochondria exhibited immunopositive staining by immunohistochemical analysis (Fig. S2D).

Although BMP4 treatment during terminal differentiation in the 3T3-L1 preadipocyte culture model did not affect differentiation efficiency significantly, as indicated by the expression of adipocyte marker proteins CCAAT/enhancer-binding protein α (C/EBPα) and PPARγ or by Oil Red O staining of adipocytes (Fig. 2 G and H). Moreover, the accumulated lipid droplets were smaller in the BMP4-treated cells than in controls as determined by the appearance of micrographic images after Oil Red staining (Fig. 2G). In addition, the BMP4-treated 3T3-L1 adipocytes also acquired the brown adipocyte gene expression phenotype, including the expression of PGC1α and PRDM16 (Fig. 2 H and I) as well as downstream genes, i.e., mtTFA, Cycs, CPT1b, MCAD, and glutamate transporter type 4 (Glut4) (Fig. 2I). The expression of UCP-1 could not be detected readily by Western blotting or with a high cycle threshold value (>30) by real-time PCR. Although the relative level of expression of PGC1a was high, the level ofUCP-1 expression was unexpectedly low.

Elevated Expression of BMP4 in Adipose Tissue Increases Whole-Body Oxygen Consumption, Insulin Sensitivity, and Protection from Metabolic Disorders Induced by a High-Fat Diet.

Basal oxygen consumption rates of BMP4 TG mice were increased substantially relative to those of control mice (Fig. 3 A and B). The mean respiratory exchange ratio (RER) of TG mice was 0.72 and that of WT mice was 0.83, indicating that the TG mice were oxidizing primarily fat, whereas the WT mice were oxidizing a mixture of carbohydrate and fat (Fig. 3C). Consistent with this shift to fat as primary fuel, the circulating levels of both triglycerides and free fatty acid decreased substantially in the BMP4 TG mice compared with control mice (Fig. 3D). Serum cholesterol levels were unchanged by expression of the transgene (Fig. 3D).

Open in a separate window

Fig. 3.

Energy expenditure and glucose metabolism in BMP4 TG mice. (A and B) Whole-body oxygen consumption rate (VO2) of WT and TG mice during a 12-h dark/12-h light cycle measured in a metabolic cage (A) and the average values for the 24-h period (B). n = 8. (C) The average values of RER in WT and TG mice calculated from data from the metabolic cage (n = 8). (D) Fasting serum triglycerides (n = 6), free fatty acid (FFA) (n = 9), and cholesterol (n = 6) levels in WT and TG mice. (E) Daily food intake of WT and Fabp4-BMP4 TG mice maintained on chow or an HFD. Mice were weighed each week for 4 wk. n = 12 mice per group. (F) Body weight gain of WT and TG mice maintained on chow or an HFD. n = 4 mice per group. (G and H) Fasting serum glucose (n = 6) (G) and insulin concentrations (n = 6) (H) in WT and TG mice maintained on chow or an HFD. (I and J) Glucose concentrations during an i.p. glucose tolerance test (n = 8) (I) or an insulin tolerance test (n = 7) (J) in WT and TG mice maintained on chow or an HFD. (K) Western blot analysis of insulin-stimulated phosphorylation of AKT in inguinal WAT extracts from WT and TG 6-mo-old mice maintained on chow. Data are expressed as means ± SEM. For WT vs. TG mice fed chow: *P < 0.05, **P < 0.01, ***P < 0.001; for WT vs. TG mice fed a high-fat diet: ^#P < 0.05, ^##P < 0.01, ^###P < 0.001. (Twenty-four-week-old mice were maintained on chow or were fed an HFD beginning at age 6 wk.)

The increase in fat metabolism by WAT in BMP4 TG mice and the associated reduction in the level of circulatory fat metabolites suggested that the BMP4 TG mice might be more insulin responsive (38). To test this possibility, metabolic studies were performed in which BMP4 TG and WT mice were fed either chow or a high-fat diet (HFD) from age 6–24 wk. Of interest, the BMP4 TG mice consumed slightly more of both diets than control mice (Fig. 3E). Body weights of the mice fed the chow diet began to diverge at approximately age 8 wk, with the TG mice gaining somewhat more weight than control mice between age 10 and 24 wk (Fig. 3F). Nonetheless, the size of the inguinal WAT fat pad increased (Fig. S2E), and the fat cells were small in size and were multilocular at age 24 wk (Fig. S2F). The difference in body weight was less pronounced in TG and control mice on the HFD (Fig. 3F). Although the fat pads of TG mice increased in size upon exposure to the HFD, the increase was less than in control mice, and fewer lipids accumulated in the liver (Fig. S2 E and F).

When mice were maintained on the chow diet, the BMP4 TG mice exhibited lower fasting serum glucose and insulin levels than control mice (Fig. 3 G and H). The fasting glucose and insulin levels were significantly increased in mice on the HFD (Fig. 3 G and H), but the levels of serum glucose and insulin were significantly reduced in BMP4 TG mice relative to controls (Fig. 3 G and H), suggesting increased insulin sensitivity. When challenged with an i.p. glucose load, the BMP4 TG mice on both chow and HFD displayed significantly improved glucose tolerance. Intraperitoneal insulin tolerance tests also showed improved insulin sensitivity in Fabp4-BMP4 mice (Fig. 3 I and J). Finally, i.p. injection of insulin resulted in a more pronounced activation of the insulin-signaling pathway in WAT of the BMP4 TG mice, as indicated by the relative increase in the level of phosphorylated Akt (phospho-Akt) (Fig. 3K).

PGC1α Mediates BMP4-Induced Conversion of White Adipocytes into Brown Fat-Like Adipocytes.

PGC1α is an important transcriptional coactivator for the expression of the UCP-1 gene (39), for the biogenesis of mitochondria, and for energy expenditure in BAT and other tissues (24, 26). To determine whether the increased energy expenditure and improved insulin sensitivity of the BMP4 TG mice is dependent on PGC1α, recombinant adenovirus expressing PGC1α shRNA was injected s.c. adjacent to one inguinal fat pad site. As a control, recombinant adenovirus expressing LacZ shRNA was injected in the contralateral site. Injection of adeno-PGC1α-shRNA into the white fat pads of BMP4 TG mice caused a significant decrease in PGC1α mRNA level compared with the contralateral control. Likewise, CPT1b, MCAD, and phosphoenolpyruvate carboxykinase 1 (Pck-1) were down-regulated (Fig. 4C). The knockdown of PGC1α expression in the fat pads produced a lighter color than in the reddish contralateral control fat pads (Fig. 4A) as well as enlargement of the fat cells and fat droplets (Fig. 4B). Thus, the phenotype induced in the BMP4 TG mice was reversed by knocking down the expression of PGC1α. Finally, activation of the insulin-signaling pathway also was inhibited by PGC1α knockdown (Fig. 4D). Moreover, regression analysis revealed a positive association between BMP4 and PGC1α mRNA expression in both subcutaneous (n = 32) and visceral (n = 22) adipose tissue of human subjects (Fig. 4 E and F).

Open in a separate window

Fig. 4.

Active metabolic WAT in Fabp4-BMP4 TG mice is dependent on PGC1α. Adenovirus expressing PGC1α shRNA was injected weekly s.c. adjacent to one side of the inguinal fat pad, and LacZ shRNA was injected at the contralateral site as a control for 4 wk beginning at age 4 wk. (A) Comparison of inguinal WAT fat pads in the TG mouse after treatment with PGC1α or Lac Z shRNA. (B) H&E staining of the inguinal WAT fat pad in the TG mouse after treatment with PGC1α or Lac Z shRNA. (Scale bar: 20 μm.) (C) qRT-PCR showing the fold induction of the expression of the indicated genes normalized to the housekeeping gene 18S in the inguinal WAT fat pad in the TG mouse after treatment with PGC1α or Lac Z shRNA (n = 4). (D) Western blot analyzing insulin-stimulated phosphorylation of AKT from the inguinal WAT fat pad in the TG mouse after treatment with PGC1α or Lac Z shRNA. (E and F) Linear regression analysis between BMP4 and PGC1α mRNA levels in subcutaneous (n = 32) (E) and visceral (n = 22) (F) adipose tissue.

P38/MAPK/ATF2 Pathway Regulates the BMP4-Induced BAT-Like Change in WAT.

Two major signaling pathways, the Smad (mothers against decapentaplegic homolog) and p38/MAPK pathways, are known for BMPs (40). Overexpression of BMP4 in WAT increased the phosphorylation state of both p38/MAPK and phosphorylated Samd1/5/8 (p-Samd1/5/8) (Fig. 5A). Because ATF2 lies downstream of p38/MAPK, its expression level also was assessed by Western blotting. Both phosphorylated ATF2 (P-ATF2) and ATF2 protein levels were up-regulated in WAT of BMP4 TG mice (Fig. 5A), suggesting that BMP4 plays a role not only in the activation of ATF2 but also the expression of the protein itself (Fig. 5A). Moreover, knockdown of ATF2 expression in inguinal WAT of BMP4 TG mice reversed the effect of BMP4 on WAT, causing fat cell enlargement and decreased expression of PGC1α and UCP-1 in fat pads injected with adeno-AFT2 shRNA compared with contralateral control fat pads (Fig. 5 B and C). The activating signaling by BMP4 on WAT was recapitulated in terminally differentiating 3T3-L1 cells in culture (Fig. 5D). Together these findings showed that activation of the p38/MAPK/ATF2 pathway and the activation of PGC1α expression by BMP4 play important roles in the induction of WAT into BAT-like tissue. Although a different phenotype was induced by the BMP4 transgene in WAT, BMP4 overexpression in BAT also activated the p38/MAPK/ATF2 pathway (Fig. S2G).

Open in a separate window

Fig. 5.

Active metabolic WAT in Fabp4-BMP4 TG mice was regulated by the p38/MAPK/ATF2 pathway. (A) Western blot analysis of the expression level of molecules involved in the BMP-signaling pathway in inguinal WAT from 2-mo-old WT and Fabp4-BMP4 TG mice maintained on a chow diet. (B) H&E staining of inguinal WAT in the TG mouse after treatment with ATF2 or Lac Z shRNA. (Scale bar: 20 μm.) (C) qRT-PCR showing the fold induction of the expression of the indicated genes normalized to the housekeeping gene 18S in the inguinal WAT of the TG mouse after treatment with ATF2 or Lac Z shRNA (n = 4). The method of ATF2 shRNA adenovirus treatment was the same as the treatment with PGC1α shRNA in Fig. 4. (D) Western blot analysis of lysates (30 μg) from differentiated 3T3-L1 adipocytes at day 4 after MDI induction with or without BMP4 (20 ng/mL).

Generation of TG Mice Overexpressing Adipose Tissue-Specific BMP4 and BMP4-Knockout Mice.

To generate mice with BMP4 specifically overexpressed in adipocytes, BMP4 cDNA (GenBank accession NM_007554) was cloned downstream of the 5.4-kb Fabp4 promoter/enhancer promoter and upstream of an SV40 intron/poly(A) sequence (50). The construct was microinjected into fertilized mouse (C57BL/6J x CBA/J F1) oocytes. BMP4 TG mice were screened by PCR using primers that specifically detect the transgene but not endogenous BMP4 (Fabp4-BMP4 Tg: cagtgatcattgccagggagaacc; gcctcctagcaggacttggcta). The TG founders were maintained by mating hemizygous animals to C57BL/6J mice. Control mice were non-TG littermates. To generate mice with an adipocyte-specific knockout of BMP4, Bmp4LoxP/LoxP mice (generously provided by Brigid Hogan, Department of Cell Biology, Duke University Medical Center, Durham, NC) were crossed with mice expressing Cre recombinase under the control of the adipocyte-specific promoter Fabp4 (Jackson Laboratory) (50). Genotyping was performed by PCR. Studies were performed in Fabp4-Cre-Bmp4LoxP/LoxP mice and littermate controls lacking the LoxP sites (Fabp4-Cre-Bmp4^+/+). Mice were maintained under 12-h light/12-h dark cycles with unlimited access to food and water. Mice were fed with chow or an HFD (51% kcal in fat, beginning at age 6 wk). The data shown were collected from experiments on male mice unless otherwise indicated. Fabp4-Bmp4 TG and non-TG WT mice from a C57BL/6J background were maintained by continuously crossing back, and Fabp4-Cre-Bmp4LoxP/loxP and Fabp4-Cre-Bmp4^+/+ mice were from a mixed background of C57BL/6J and 129/Black Swiss. Thus, slight variations between non-transgenic WT and Fabp4-Cre-Bmp4^+/+ values may reflect strain-specific differences. All studies were approved by the Animal Care and Use Committee of the Fudan University Shanghai Medical College and followed the National Institute of Health guidelines on the care and use of animals.

Glucose and Insulin Tolerance Tests.

For the glucose tolerance test, mice were injected i.p. with D-glucose (2 mg/g body weight) after an overnight fast, and tail blood glucose levels were monitored. For the insulin tolerance test, mice fed ad libitum were injected i.p. with human insulin (Eli Lilly) (0.75 mU/g body weight) around 2:00 PM, and tail blood glucose levels were monitored.

Metabolic Studies.

Three-month-old mice were housed and monitored individually in a metabolic cage (Columbia Instruments) with free access to regular chow and drinking water for 48 h. Each cage was monitored for metabolic parameters (including oxygen consumption and carbon dioxide production) at 25-min intervals throughout the 48 h period. Parameters of oxygen consumption (mLkg⁻¹h⁻¹), carbon dioxide production (mLkg⁻¹h⁻¹), and RER (CO₂/VO2) were calculated for each mouse divided by its body weight. Representative graphs of oxygen consumption and RER represent data for eight mice from each group.

Measurements of Blood Parameters.

Mice at different ages were fasted overnight, and blood samples were collected by retroorbital bleeding methods. Sera were prepared and used for measurements. Glucose, triglycerides, and cholesterol levels were determined using the Sysmex Chemix-180 automatic biochemical analysis device (Sysmex Infosystems). ELISA kits were used to determine leptin (Raybiotech), insulin (Mercodia), and free fatty acid (Lengton Bioscience) levels in mouse sera.

H&E Staining and Cell Size Quantitation.

Standard H&E staining was performed on 5-μm paraffin sections of WAT and interscapular brown adipose tissue. Cell diameter was measured in the H&E-stained sections of three individual samples in each group using Image J.

Isolation of SVF and Adipocytes from Adipose Tissue.

Adipose tissue was harvested and the SVF cells were isolated by enzymatic digestion (collagenase VIII; Sigma). The digested tissue was filtered through a 100-μm mesh filter to remove debris and was centrifuged. The adipocytes floated above the supernatant. The cellular pellet involving the SVF was resuspended with an ammonium chloride lysis buffer to remove red blood cells.

Oil Red O and Nile Red Staining for Lipid.

In vitro differentiated cells were fixed for 20 min in buffered formalin and stained with Oil Red O for 60 min. Isolated cells were resuspended in PBS, Nile red (stock: 0.5 mg/mL in acetone) was added to the preparation to effect a l:100 dilution, and cells were incubated for 5 min for flow cytometry.

Cell Culture and Induction of Adipogenesis.

3T3-L1 preadipocytes were plated at low density and cultured in DMEM containing 10% (vol/vol) calf serum. Two days postconfluence (designated day 0), cells were induced to differentiate with DMEM containing 10% (vol/vol) FBS, 1 μg/mL insulin, 1 μM dexamethasone, and 0.5 mM 3-isobutyl-1-methyl-xanthine until day 2. Cells then were fed with DMEM supplemented with 10% (vol/vol) FBS and 1 μg/mL insulin for 2 d, after which they were fed every other day with DMEM containing 10% (vol/vol) FBS. For BMP4 treatment, 20 ng/mL of purified recombinant BMP4 (R&D Systems) was added to the medium during the differentiation from day 0 to day 8.

qRT-PCR.

cDNA synthesized from total RNA was analyzed in a Sequence Detector (Q5; Bio-Rad) with specific primers and SYBR Green PCR Master reagents (ABI). The relative abundance of mRNAs was calculated with 18S mRNA as the invariant control. The primers were from PrimerBank (http://pga.mgh.harvard.edu/primerbank/) or as described in refs. 14–16, 20, and 51.

Antibodies and Immunoblotting.

WAT and BAT or cultured cells were homogenized in lysis buffer containing 2% (wt/vol) SDS and 60 mM TrisHCl (pH 6.8) and were loaded onto the gel for electrophoresis. Proteins then were transferred onto nitrocellulose membrane and immunoblotted with specific antibodies. For determination of insulin-stimulated p-AKT, inguinal WAT was dissected from mice 5 min after i.p. injection of insulin. Antibodies used were BMP4 (Millipore), p38/MAPK, phos-p38/MAPK, Smad1, p-Smad1/5/8, Akt, and p-hr473-Akt (Cell Signaling Technology), actin (Sigma-Aldrich), PGC1α and HSP90 (Santa Cruz Biotechnology), and PRDM16 and UCP-1 (Abcam).

Adenoviral Expression Vectors and Infection.

The adenoviral expression vector pBlock-it (Invitrogen) encoding shRNA of the PGC1α and ATF2 genes was constructed according to the manufacturer’s protocols. The shRNA sequences were PGC1α: GGTGGATTGAAGTGGTGTAGA and ATF2: GTGAGGAGCCTT CTGTTGTA. Adenovirus was amplified and purified using Sartorius Adenovirus Purification Kits. Adenovirus solution was injected s.c. adjacent to the inguinal fat pad weekly for 4 wk in mice beginning at age 4 wk.

Fabp4-BMP4 TG mice were generated at Model Animal Research Center of Nanjing University. BMP4^LoxP/LoxP mice were generously provided by Dr. Brigid Hogan. This research was supported in part by National Key Basic Research Project Grants 2011CB910201 and 2013CB530601, State Key Program of the National Natural Science Foundation Grant 31030048C120114, and Shanghai Key Science and Technology Research Project Grant 10JC1401000 (to Q.-Q.T.), and by National Natural Science Foundation Grant 30870510 (to X.L.). The Department of Biochemistry and Molecular Biology of Fudan University Shanghai Medical College is supported by Shanghai Leading Academic Discipline Project B110 and 985 Project 985III-YFX0302.