Abstract
Introduction
Human mesenchymal stem cell (hMSC) proliferation and development is regulated by many signalling pathways. gamma-Secretases play an important role in Notch signalling as well as other processes that are involved in developmental decisions, but their role in hMSC proliferation and cell fate decisions has not been explored.Objective
To investigate the role of gamma-secretases in hMSC proliferation and differentiation.Materials and methods
Using the gamma-secretase inhibitor N-[N-(3,5-Difluorophenacetyl-L-alanyl]-S-phenylglycine t-butyl ester (DAPT), we investigated their role in hMSC growth and differentiation to chondrogenic, osteogenic and adipogenic fates.Results
We found that inhibiting gamma-secretases reduced the rate of hMSC proliferation, and altered hMSC differentiation in vitro. Addition of DAPT had an inhibitory effect on chondrogenesis resulting in impaired cartilage matrix production and altered chondrocyte morphology. DAPT treated chrodrocytic pellets had reduced levels of Hes1 and Hey1 suggesting that these effects are mediated via Notch signalling. Addition of the DAPT inhibitor to osteogenic cultures did not alter the appearance of bone markers, however, adipogenesis occurred in these cultures in a DAPT concentration-dependent manner. DAPT did not enhance adipogenesis in the presence of a potent adipogenic cocktail, but had an adipogenic effect when combined with dexamethasone only.Conclusion
We conclude that gamma-secretases play an important role in both hMSC proliferation and differentiation.Free full text
Inhibition of γ‐secretases alters both proliferation and differentiation of mesenchymal stem cells
Abstract
Abstract. Introduction: Human mesenchymal stem cell (hMSC) proliferation and development is regulated by many signalling pathways. γ‐Secretases play an important role in Notch signalling as well as other processes that are involved in developmental decisions, but their role in hMSC proliferation and cell fate decisions has not been explored. Objective: To investigate the role of γ‐secretases in hMSC proliferation and differentiation. Materials and methods: Using the γ‐secretase inhibitor N‐[N‐(3,5‐Difluorophenacetyl‐L‐alanyl]‐S‐phenylglycine t‐butyl ester (DAPT), we investigated their role in hMSC growth and differentiation to chondrogenic, osteogenic and adipogenic fates. Results: We found that inhibiting γ‐secretases reduced the rate of hMSC proliferation, and altered hMSC differentiation in vitro. Addition of DAPT had an inhibitory effect on chondrogenesis resulting in impaired cartilage matrix production and altered chondrocyte morphology. DAPT treated chrodrocytic pellets had reduced levels of Hes1 and Hey1 suggesting that these effects are mediated via Notch signalling. Addition of the DAPT inhibitor to osteogenic cultures did not alter the appearance of bone markers, however, adipogenesis occurred in these cultures in a DAPT concentration‐dependent manner. DAPT did not enhance adipogenesis in the presence of a potent adipogenic cocktail, but had an adipogenic effect when combined with dexamethasone only. Conclusion: We conclude that γ‐secretases play an important role in both hMSC proliferation and differentiation.
INTRODUCTION
Human adult mesenchymal stem cells (hMSC) are bone marrow‐derived cells that have the potential to differentiate into various mesodermal lineages, including bone, cartilage, muscle and fat (Pittenger et al. 1999). There is great interest in hMSC due to their therapeutic potential, as well as their use as a model system for human developmental processes (Le Blanc & Pittenger 2005).
During development, the tight control of stem cell self‐renewal and differentiation is required to generate complex organized tissues and organs. One mechanism employed to coordinate stem cell differentiation is the activation and inhibition of specific signalling pathways. Manipulation of hMSC in vitro, provides an ideal model system to investigate the role of signalling pathways in the commitment and progression of differentiation towards specific lineages. To date, wingless‐type MMTV integration site family members (Wnts) (De Boer et al. 2004; Gaur et al. 2005), bone morphogenetic proteins (BMPs) (Sottile & Seuwen 2000), mitrogen‐activated protein kinase family members (Jaiswal et al. 2000; Tuli et al. 2003), transforming growth factor family β members (TGFβs) (Mishra et al. 2005) and fibroblast growth factors (FGFs) (Tsutsumi et al. 2001; Davidson et al. 2005) are all implicated in the regulation of hMSC differentiation. For example, there is evidence that Wnt signalling is required for hMSC self‐renewal, although it also promotes osteogenesis and chondrogenesis, but is inhibitory to adipogenic differentiation (De Boer et al. 2004; Gaur et al. 2005). Hence, a complex picture is emerging whereby activation of specific signalling pathways either promotes or inhibits lineage‐specific differentiation.
Notch signalling is another pathway commonly involved in developmental processes, and is evolutionarily conserved from Drosophila to mammals (Artavanis‐Tsakonas et al. 1999). Notch receptors interact with membrane bound delta/jagged ligands, hence signalling is only activated upon direct cell‐to‐cell contact (Baron et al. 2002 and references therein). Binding of ligand to the Notch receptor results in proteolytic cleavage of the receptor and the release of the intracellular domain. This proteolytic cleavage is a multi‐step process, with the γ‐secretase enzyme, presenilin, catalysing the final step. The cleaved Notch intracellular domain translocates into the nucleus and activates transcription of Hes and Hey gene family members. Hes and Hey proteins are basic helix‐loop‐helix (bHLH) transcriptional regulators that act as both homo‐ and hetero‐dimers in repressing the transcription of target genes. This inhibition can occur either directly by the Hes and Hey dimer binding to specific repressor binding sites, or indirectly by binding to bHLH transcription factors, such as myogenic differentiation agent 1, and preventing them from forming functional hetero‐dimers with other bHLH family proteins (Iso et al. 2003).
The role of Notch signalling in the developmental processes of a variety of organisms has been studied by the use of γ‐secretase inhibitors including L‐685 458 and DAPT (Micchelli et al. 2003; Tian et al. 2003). Exposure of Drosophila to DAPT blocks the release of Notch intracellular domain and produces the same phenotype as that resulting from mutations in the components of the Notch signalling pathway (Micchelli et al. 2003). DAPT is also an accepted inhibitor of Notch signalling in in vitro studies (Cheng et al. 2003; van den Brandt et al. 2004; Li et al. 2006). However, it is known that signalling molecules other than Notch protein act as targets for γ‐secretases and therefore caution needs to be taken when interpreting data from experiments using such inhibitors (Kopan & Ilagan 2004).
Various reports have implicated γ‐secretases and Notch signalling as being involved in chondrogenic, osteogenic and adipogenic development (Dowthwaite et al. 2004; de Jong et al. 2004; Ross et al. 2004). A variety of cell types and species was used in these studies, however, the role of γ‐secretases in hMSC biology has not previously been determined. To address this, we used the inhibitor DAPT to investigate the role of γ‐secretases in proliferating and differentiating hMSC.
MATERIALS AND METHODS
hMSC isolation and culture
Mesenchymal stem cells were isolated from human bone marrow aspirates obtained after informed consent according to local ethical guidelines. Donors were healthy individuals between 24 and 40 years old. After aspiration, the mononuclear fraction of bone marrow was separated by Ficoll gradient centrifugation (Ficoll‐Paque PLUS, GE, Little Chalfront, UK). hMSC were obtained by washing the bone marrow mononuclear cells twice with phosphate‐buffered saline (PBS) and finally re‐suspending in Mesencult medium (Stem Cell Technologies, Vancouver, BC, Canada) containing 1 ng/ml bFGF (RnD Systems, Minneappolis, MN, USA) seeding 1 × 105 cells/cm2 on tissue culture plates. The hMSC adhered to the culture dish and non‐adherent cells were washed off in a medium change 2 days after isolation. hMSC were routinely passaged every 3 days using 0.25% Trypsin ethylenediaminetetraacetic acid (Invitrogen, Paisley, UK) and cells were re‐seeded on tissue culture plastic at a density of 2–5 × 103/cm2. Experiments were performed on hMSC isolated from three donors. Similar trends were observed between donors and therefore results from a single bone marrow are presented.
Growth curves
Growth curve assays were performed every 3 days in 6‐well plates (surface area: ~9.6 cm2). Cells were grown in Mesencult medium containing 1 ng/ml bFGF. Initially 60 000 cells were seeded and were allowed to grow for 3 days, when they were detached from the well using 300 µl of 0.25% Trypsin ethylenediaminetetraacetic acid, re‐suspended with 1 ml of medium and were counted using a haemocytometer. After the counts, 60 000 cells were seeded. Cell counts were performed in triplicate per culture condition.
DAPT treatment
DAPT (Merck Biosciences, Darmstadt, Germany) was dissolved in DMSO (Sigma, Pool, UK) to make 20 mm and 10 mm stocks that were then added to the hMSC cultures at 1 : 1000 dilution, producing a final concentration of 10 µm DAPT and 20 µm DAPT. In all cases where DAPT treatment was used in conjunction with differentiation medium, DAPT or DMSO was applied 16 h prior to induction of differentiation and alongside the differentiation inducers throughout the differentiation. hMSC were allowed to reach confluence before DAPT or DAPT plus 100 nm dexamethasone treatment.
Chondrogenic differentiation
Chondrogenic differentiation was adapted from Sekiya et al. (2002). Chondrocyte differentiation medium comprised high glucose DMEM (Invitrogen) supplemented with 1% penicillin/streptomycin (Invitrogen), 10−7 m dexamethasone (Sigma), 50 µg/ml ascorbate‐2‐phosphate (Sigma), 40 µg/ml l‐proline (Sigma), 100 µg/ml sodium pyruvate (Invitrogen), 50 mg/ml ITS + Premix (6.25 µg/ml insulin, 6.25 µg/ml transferrin, 6.25 ng/ml selenious acid, 1.25 mg/ml bovine serum albumin, 5.35 mg/ml linoleic acid) (Becton Dickinson Biosciences, Franklin Lakes, NJ, USA), 500 ng/ml BMP6, 10 ng/ml TGFβ3. hMSC (250 000) were suspended in 500 µl of chondrocyte differentiation media, placed in a 15‐ml falcon and centrifuged at 600 g for 5 min allowing the cells to form a loose pellet (day 0). These pellets were incubated at 37 °C, 5% CO2 for 4 days, at which time the differentiation medium was changed. Media changes were then performed every 3 days. Pellets were harvested on day 21 unless otherwise stated. Six pellets were grown per condition, and the experiment was performed in duplicate. In the case of DAPT treatment, the hMSC were exposed to either 1 µl/ml DMSO, 1 µl/ml DMSO with 10 µm DAPT or 1 µl/ml DMSO with 20 µm DAPT 16 h prior to growing in pellet cultures and throughout the differentiation process.
Pellet measurements were taken using a graticule eye‐piece. For histology, pellets were embedded in paraffin wax and were sectioned at 10 µm. Slides were dewaxed in xylene for 10 min, re‐hydrated in 100% ethanol 10 min, 90% ethanol 5 min, 70% ethanol 5 min and washed in distilled water. Toluidine blue was used to depict the proteoglycan content of the pellets. The stain (0.1% w/v toluidine blue dissolved in 0.1 m sodium phosphate buffer [188 ml of 0.1 m NaH2PO4 and 12 ml 0.1 m Na2HPO4]) was applied for 45 s and was washed with distilled water. Tissues were then dehydrated by consecutive ethanol washes (70%, 90% and 100%), and were dipped in xylene for 5 min. Samples were air‐dried and mounted with DPX.
Adipogenic differentiation
hMSC were grown to confluence, at which point the adipogenic medium comprising Mesencult and supplement with 1 µm dexamethasone (Sigma), 500 µm IBMX (Sigma), 2 µm indomethacin (Sigma), 10 µg/ml insulin (Roche) was added. The medium was changed every 3 days. In the case of DAPT treatment, hMSC were exposed to either 1 µl/ml DMSO, 10 µm DAPT or 20 µm DAPT 16 h prior to exposing to differentiation media and thereafter.
Adipocytes were identified using oil red O lipid stain (Sigma). This entailed removing the medium from the plates, rinsing the cells with PBS, and fixing them by applying 8 ml of 4% formaldehyde, 75 mm sodium phosphate buffer, 3% methanol for 30 min. Fixative was then removed and the plate was washed three times with PBS, before applying 8 ml of oil red O dye (600 µg/ml oil red O, dissolved in isopropanol; diluted 60 : 40 in water and filtered) and incubating in the dark for 1–4 h. Plates were rinsed with 50% ethanol and covered with PBS.
Osteogenic differentiation
hMSC were grown to confluence, at which point the osteogenic medium, comprising Mesencult supplemented with 100 nm dexamethasone, 10 µmβ‐glycerol phosphate (Sigma) and 50 µg/ml ascorbate‐2‐phosphate (Sigma) was added. The medium was changed every 3 days. In the case of DAPT treatment, hMSC were exposed to either 1 µl/ml DMSO, 10 µm DAPT or 20 µm DAPT 16 h prior to exposing to differentiation media and throughout differentiation.
A kit was used to detect the presence of alkaline phosphatase (Sigma). This involved exposing the cells to a 2% citrate/60% acetate solution for 30 s, and then rinsing twice with dH2O. The stain (one dye capsule dissolved in 49 ml dH2O with 2 ml Naphthol AS‐MX) was applied for 30 s, after which the cells were rinsed with dH2O for 2 min. Mayer's haematoxylin (Sigma) solution was applied for 10 min, when it was removed by two washes with dH2O.
RNA isolation and reverse transcription‐polymerase chain reaction
RNA was isolated from cells using the RNAeasy kit (Qiagen, Sussex, UK). Reverse transcription‐polymerase chain reactions (RT‐PCR) were performed using the Superscript II enzyme kit (Invitrogen) according to the manufacturer's instructions and with 100 ng starting RNA. The subsequent PCRs were performed using DyNAzyme kits (Finnzymes, Espoo, Finland) in 25 µL reaction volumes using 2.5 µl of 10X reaction buffer containing 50 mm MgCl2, 1 µl of 10 mm dNTP (Promega), 2.5 µl of 10 µm of each primer (Thermo, Ulm, Germany), 0.25 µl of 5 U/ml Taq polymerase, 1.25 µl DMSO and 1 µl cDNA. The cycling times were, 94 °C for 2 min; and then 28 cycles of 94 °C for 30 s, 55 °C for 1 min, 72 °C for 45 s; 72 °C for 10 min. Reactions were then run on a 1.5% agarose gel and the following primers were used:
- Hes1 (forward): CTACCCCAGCCAGTGTCAAC
- Hes1 (reverse): CATTGATCTGGGTCATGCAG
- Hey1 (forward): AACTGTTGGTGGCCTGAATC
- Hey1 (reverse): CCAGTTCAGTGGAGGTCGTT
- Col2a1 (forward): TTCAGCTATGGAGATGACAATC
- Col2a1 (reverse): AGAGTCCTAGAGTGACTGAG
- GAPDH (forward): GATCATCAGCAATGCCTCCT
- GAPDH (reverse): TGTGGTCATGAGTCCTTCCA
RESULTS
DAPT effect on hMSC proliferation
To examine the role of γ‐secretases on hMSC proliferation, we exposed proliferating hMSC to the γ‐secretase inhibitor DAPT at 10 and 20 µm concentrations. The addition of 10 µm DAPT slowed hMSC growth and finally inhibited cell division after six passages (Fig. 1). Increasing the concentration of DAPT to 20 µm inhibited cell division within four passages and resulted in growth arrest. Therefore, although DAPT did not immediately inhibit hMSC growth, long‐term exposure led to growth arrest, implicating a role for γ‐secretases in MSC proliferation in vitro.
DAPT effect on chondrogenesis
We examined the impact of γ‐secretases on the ability of hMSC to differentiate towards the chondrocytic lineage using a pellet culture model system. The addition of DAPT to hMSC pellet cultures significantly reduced the final pellet size by ~50%, as demonstrated by graticule eye‐piece measurements (Fig. 2a). The effect was not enhanced by doubling the concentration of DAPT. Toluidine blue‐stained sections of the pellets, presented in Fig. 2(b), show that the control and DMSO‐treated samples had accumulated large amounts of cartilage matrix and the cells within the matrix were round and set within lacunae – a morphological appearance typical of chondrocytes. The DAPT‐treated pellets embodied a pronounced reduction in matrix accumulation compared to control cultures and the cells had a less uniform appearance. In addition, the DAPT‐treated cultures had an outer rim of spindle cells surrounding the cartilaginous core. Exposing chondrogenic cultures to the higher concentration of DAPT (20 µm) seemed to enhance this effect.
RT‐PCR analysis of RNA isolated from cartilage pellets (at day 21) detected the expression of Notch effectors Hes1 and Hey1 in control and DMSO treated pellets (Fig. 2c). Their expression was diminished by the addition of DAPT. Although the DAPT inhibitor caused a considerable decrease in mRNA levels, it did not completely obliterate the expression of Hes1/Hey1. In order to show that decrease in Hes1 and Hey1 levels was a direct consequence of DAPT treatment, rather than an indirect consequence of the impaired chondrogenic differentiation, RNA was also isolated from control, DMSO and DAPT‐treated pellets, 6 h after the exposure to differentiation reagents and the same results were observed as above (data not shown).
DAPT effect on osteogenesis and adipogenesis
DAPT did not alter osteogenic differentiation, as assessed by alkaline phosphatase and alizarin red staining under transmission light microscopy (Fig. 3a and data not shown). However, it was noted that addition of DAPT to osteogenic cultures induced formation of a large number of cells containing lipid droplets, which had typical adipocyte morphology under higher magnification (Fig. 3a and 3a inset). While it is common to note an occasional adipocyte in bone‐forming cultures, adipogenesis was significantly increased in the DAPT‐treated cultures, demonstrated by a 7‐ and 12‐fold rise in adipocyte numbers in the presence of 10 µm and 20 µm DAPT, respectively (Fig. 3b).
Treatment of hMSC with either 10 µm or 20 µm DAPT in adipogenic cultures had no visible effect on adipocyte development, as assessed by oil red O staining (Fig. 4a). Therefore, to elucidate further the adipogenic effect of DAPT seen in the osteogenic cultures above, we exposed confluent hMSC to the DAPT inhibitor alone and in the presence of 100 nm dexamethasone. DAPT by itself was not a sufficient stimulus to induce adipogenesis but together with 100 nm dexamethasone, lipid laden cells appeared as in the osteogenic cultures, indicating that the combination of these two chemicals was sufficient to induce adipogenesis (Fig. 4b). Figure 4(c) illustrates quantification of this result.
DISCUSSION
Development of complex tissues and organs requires tight control on progenitor cell proliferation and differentiation. This control is mediated by the complex interplay of different signalling pathways. γ‐Secretases target a range of signalling pathways, but play a pivotal role in regulating Notch signalling, which is an evolutionary conserved pathway that influences the balance between proliferation and differentiation of a diverse range of progenitor cells (Sarmento et al. 2005). By using the γ‐secretase inhibitor DAPT, we show for the first time that γ‐secretases are involved in both the proliferation and differentiation of hMSC to mesodermal tissues.
Here, we demonstrate that DAPT treatment of proliferating hMSC resulted in growth arrest, pointing to a role for γ‐secretases in hMSC self‐renewal. γ‐secretases have also been implicated in the self‐renewal of HSCs, where the interplay between Wnt and Notch pathways is required to maintain cell proliferation (Duncan et al. 2005). It is possible that a similar conserved mechanism is involved in hMSC proliferation, because Wnt signalling is also known to be active and to be required for hMSC expansion (Etheridge et al. 2004; Duncan et al. 2005).
Besides the role of γ‐secretases in hMSC proliferation, we show that it is also involved in cell fate decisions. The addition of DAPT to hMSC undergoing chondrogenesis significantly impaired their differentiation. Inhibiting γ‐secretases did not inhibit pellet formation but reduced pellet size due to decreased matrix production. Addition of DAPT also caused morphological changes in the chondrocytes, in particular in the outer layers of the pellet where they did not appear rounded or produce the lacunae as seen with the untreated control pellets, possibly because of the partial penetrance of the inhibitor. The expression of downstream Notch target genes Hes1 and Hey1, normally present during hMSC chondrogenesis, was also dramatically reduced, although not completely abolished, during DAPT treatment. This suggests that the effect of the γ‐secretase inhibitor is mediated via Notch signalling. Residual expression of Hes1 and Hey1 in the chondrocytic pellets may be related to cells in the core of the pellet where the DAPT may have failed to penetrate. These results are in accordance with previous findings where DAPT treatment was reported to impair proteoglycan production in chondroblasts isolated from joints, but in contrast the results obtained with the ATDC5 cell line where Hes1 over‐expression lead to a suppression of chondrogenic differentiation (Watanabe et al. 2003; Dowthwaite et al. 2004). One explanation for this might be that a transient Notch signal is required for chondrogenesis, and that either blocking or continually activating Notch signalling results in inhibition of chondrogenesis.
γ‐Secretases also appear to be involved in the cell fate choice between osteogenesis and adipogenesis as the addition of DAPT to osteogenic cultures caused adipocyte formation. The adipogenic effect can also be achieved by addition of DAPT and 100 nm dexamethasone but not by the addition of DAPT alone. The extent of adipogenic induction in these cultures is dependent on the DAPT concentration as the number of adipocytes nearly doubled when the DAPT concentration was increased from 10 µm to 20 µm. When DAPT was added to hMSC differentiating in adipogenic media, no further enhancement of adipogenesis was seen. These cells were exposed to a very potent adipogenic cocktail, and it is therefore probable that they had already reached their full adipogenic capacity. Previous studies on the role of Notch signalling in adipogenesis have produced contradictory results. Inhibition of Notch signalling in the murine preadipocyte cell line 3T3L1 impaired adipogenesis, while murine embryonic fibroblast and murine embryonic stem cell adipogenesis was unimpaired (Nichols et al. 2004; Ross et al. 2004). In contrast, our observations argue that γ‐secretases play an inhibitory role for human adipogenesis. As, only a small proportion of hMSC differentiated to adipocytes in response to DAPT and dexamethasone, other factors are required for efficient commitment of cells to fat.
DAPT is a specific γ‐secretase inhibitor, but the function of such enzymes is not exclusive to the Notch pathway (Iwatsubo 2004; Kopan & Ilagan 2004). We therefore can not conclude that all the effects we observed are solely due to Notch signalling. However, in our chondrogenic cultures we observed a concomitant inhibition of extracellular matrix production and a significant decrease in Hes1 and Hey1 mRNA expression (downstream targets of Notch signalling) upon addition of DAPT, implying a direct role for Notch signalling in this process. We observed no decrease in Hes1 and Hey1 in response to DAPT treatment in our proliferation assay, nor in our adipogenic and osteogenic cultures, as the level of their expression were below detectable threshold of our RT‐PCR analysis (data not shown). Because the Hes and Hey family have been shown to play a part in chondrogenic, adipogenic and osteogenic differentiation in a number of cell lines, it seems more plausible that our findings are due to the disruption of Notch signalling (Watanabe et al. 2003; Ross et al. 2004; Zamurovic et al. 2004 , de Jong et al. 2004). Further experiments need to be performed to conclusively demonstrate that the DAPT effects reported in this paper are mediated solely by Notch. These experiments are complicated due to the low transfection efficiency of primary MSC preventing the use of molecular tools.
Taken together, our results infer a role for γ‐secretases in the control of hMSC proliferation and cell fate determination. Signalling pathways dependent on γ‐secretases are likely to interact with the other signalling pathways already implicated in hMSC function, as a means of regulating stem cell function. Our findings provide a platform on which to investigate further the factors regulating hMSC differentiation.
ACKNOWLEDGEMENT
This article was supported by Cancer Research, UK, and the Wellcome Trust, UK. The authors would like to thank Kwee Yong, Department of Haematology, UCL, for providing the bone marrow samples.
REFERENCES
- Artavanis‐Tsakonas S, Rand MD, Lake RJ (1999) Notch signaling: cell fate control and signal integration in development. Science 284, 770–776. [Abstract] [Google Scholar]
- Baron M, Aslam H, Flasza M, Fostier M, Higgs JE, Mazaleyrat SL, Wilkin MB (2002) Multiple levels of Notch signal regulation (review). Mol. Membr. Biol. 19, 27–38. [Abstract] [Google Scholar]
- Van Den Brandt J, Voss K, Schott M, Hunig T, Wolfe MS, Reichardt HM (2004) Inhibition of Notch signaling biases rat thymocyte development towards the NK cell lineage. Eur. J. Immunol. 34, 1405–1413. [Abstract] [Google Scholar]
- Cheng HT, Miner JH, Lin M, Tansey MG, Roth K, Kopan R (2003) γ‐Secretase activity is dispensable for mesenchyme‐to‐epithelium transition but required for podocyte and proximal tubule formation in developing mouse kidney. Development 130, 5031–5042. [Abstract] [Google Scholar]
- Davidson D, Blanc A, Filion D, Wang H, Plut P, Pfeffer G, Buschmann MD, Henderson JE (2005) Fibroblast growth factor (FGF) 18 signals through FGF receptor 3 to promote chondrogenesis. J. Biol. Chem. 280, 20 509–20 515. [Abstract] [Google Scholar]
- De Boer J, Wang HJ, Van Blitterswijk C (2004) Effects of Wnt signaling on proliferation and differentiation of human mesenchymal stem cells. Tissue Eng 10, 393–401. [Abstract] [Google Scholar]
- Dowthwaite GP, Bishop JC, Redman SN, Khan IM, Rooney P, Evans DJ, Haughton L, Bayram Z, Boyer S, Thomson B, Wolfe MS, Archer CW (2004) The surface of articular cartilage contains a progenitor cell population. J. Cell Sci. 117, 889–897. [Abstract] [Google Scholar]
- Duncan AW, Rattis FM, Dimascio LN, Congdon KL, Pazianos G, Zhao C, Yoon K, Cook JM, Willert K, Gaiano N, Reya T (2005) Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat. Immunol. 6, 314–322. [Abstract] [Google Scholar]
- Etheridge SL, Spencer GJ, Heath DJ, Genever PG (2004) Expression profiling and functional analysis of Wnt signaling mechanisms in mesenchymal stem cells. Stem Cells 22, 849–860. [Abstract] [Google Scholar]
- Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, Javed A, Van Wijnen AJ, Stein JL, Stein GS, Lian JB (2005) Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J. Biol. Chem. 280, 33 132–33 140. [Abstract] [Google Scholar]
- Iso T, Kedes L, Hamamori Y (2003) HES and HERP families: multiple effectors of the Notch signaling pathway. J. Cell Physiol. 194, 237–255. [Abstract] [Google Scholar]
- Iwatsubo T (2004) The γ‐secretase complex: machinery for intramembrane proteolysis. Curr. Opin. Neurobiol. 14, 379–383. [Abstract] [Google Scholar]
- Jaiswal RK, Jaiswal N, Bruder SP, Mbalaviele G, Marshak DR, Pittenger MF (2000) Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen‐activated protein kinase. J. Biol. Chem. 275, 9645–9652. [Abstract] [Google Scholar]
- De Jong DS, Steegenga WT, Hendriks JM, Van Zoelen EJ, Olijve W, Dechering KJ (2004) Regulation of Notch signaling genes during BMP2‐induced differentiation of osteoblast precursor cells. Biochem. Biophys. Res. Commun. 320, 100–107. [Abstract] [Google Scholar]
- Kopan R, Ilagan M (2004) γ‐Secretase: proteasome of the membrane? Nat. Rev. Mol Cell Biol. 5, 499–504. [Abstract] [Google Scholar]
- Le Blanc K, Pittenger M (2005) Mesenchymal stem cells: progress toward promise. Cytotherapy 7, 36–45. [Abstract] [Google Scholar]
- Li H, Yu B, Zhang Y, Pan Z, Xu W, Li H (2006) Jagged1 protein enhances the differentiation of mesenchymal stem cells into cardiomyocytes. Biochem. Biophys. Res. Commun. 341, 320–325. [Abstract] [Google Scholar]
- Micchelli CA, Esler WP, Kimberly WT, Jack C, Berezovska O, Kornilova A, Hyman BT, Perrimon N, Wolfe MS (2003) γ‐Secretase/presenilin inhibitors for Alzheimer's disease phenocopy Notch mutations in Drosophila . FASEB J. 17, 79–81. [Abstract] [Google Scholar]
- Mishra L, Derynck R, Mishra B (2005) Transforming growth factor‐β signaling in stem cells and cancer. Science 310, 68–71. [Abstract] [Google Scholar]
- Nichols AM, Pan Y, Herreman A, Hadland BK, De Strooper B, Kopan R, Huppert SS (2004) Notch pathway is dispensable for adipocyte specification. Genesis 40, 40–44. [Abstract] [Google Scholar]
- Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284, 143–147. [Abstract] [Google Scholar]
- Ross DA, Rao PK, Kadesch T (2004c) Dual roles for the Notch target gene Hes‐1 in the differentiation of 3T3‐L1 preadipocytes. Mol. Cell. Biol. 24, 3505–3513. [Europe PMC free article] [Abstract] [Google Scholar]
- Sarmento LM, Huang H, Limon A, Gordon W, Fernandes J, Tavares MJ, Miele L, Cardoso AA, Classon M, Carlesso N (2005) Notch1 modulates timing of G1‐S progression by inducing SKP2 transcription and p27 Kip1 degradation. J. Exp. Med. 202, 157–168. [Europe PMC free article] [Abstract] [Google Scholar]
- Sekiya I, Vuoristo JT, Larson BL, Prockop DJ (2002) In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chrondogenesis. Proc. Natl. Acad. Sci. U.S.A. 99, 4397–4402. [Europe PMC free article] [Abstract] [Google Scholar]
- Sottile V, Seuwen K (2000) Bone morphogenetic protein‐2 stimulates adipogenic differentiation of mesenchymal precursor cells in synergy with BRL 49653 (rosiglitazone). FEBS Lett. 475, 201–204. [Abstract] [Google Scholar]
- Tian G, Ghanekar SV, Aharony D, Shenvi AB, Jacobs RT, Liu X, Greenberg BD (2003) The mechanism of γ‐secretase: multiple inhibitor binding sites for transition state analogs and small molecule inhibitors. J. Biol. Chem. 278, 28 968–28 975. [Abstract] [Google Scholar]
- Tsutsumi S, Shimazu A, Miyazaki K, Pan H, Koike C, Yoshida E, Takagishi K, Kato Y (2001) Retention of multilineage differentiation potential of mesenchymal cells during proliferation in response to FGF. Biochem. Biophys. Res. Commun. 288, 413–419. [Abstract] [Google Scholar]
- Tuli R, Tuli S, Nandi S, Huang X, Manner PA, Hozack WJ, Danielson KG, Hall DJ, Tuan RS (2003) Transforming growth factor‐β‐mediated chondrogenesis of human mesenchymal progenitor cells involves N‐cadherin and mitogen‐activated protein kinase and Wnt signaling cross‐talk. J. Biol. Chem. 278, 41 227–41 236. [Abstract] [Google Scholar]
- Watanabe N, Tezuka Y, Matsuno K, Miyatani S, Morimura N, Yasuda M, Fujimaki R, Kuroda K, Hiraki Y, Hozumi N, Tezuka K (2003) Suppression of differentiation and proliferation of early chondrogenic cells by Notch. J. Bone Miner. Metab. 21, 344–352. [Abstract] [Google Scholar]
- Zamurovic N, Cappellen D, Rohner D, Susa M (2004) Coordinated activation of notch, Wnt, and transforming growth factor‐β signaling pathways in bone morphogenic protein 2‐induced osteogenesis. Notch target gene Hey1 inhibits mineralization and Runx2 transcriptional activity. J. Biol. Chem. 279, 37 704–37 715. [Abstract] [Google Scholar]
Articles from Cell Proliferation are provided here courtesy of Wiley-Blackwell
Full text links
Read article at publisher's site: https://doi.org/10.1111/j.1365-2184.2007.00426.x
Read article for free, from open access legal sources, via Unpaywall: https://europepmc.org/articles/pmc6495689?pdf=render
Citations & impact
Impact metrics
Citations of article over time
Alternative metrics
Discover the attention surrounding your research
https://www.altmetric.com/details/144071299
Article citations
Spatial transcriptomic interrogation of the murine bone marrow signaling landscape.
Bone Res, 11(1):59, 06 Nov 2023
Cited by: 0 articles | PMID: 37926705 | PMCID: PMC10625929
Sustained notch signaling inhibition with a gamma-secretase inhibitor prevents traumatic heterotopic ossification.
J Orthop Translat, 42:31-42, 01 Aug 2023
Cited by: 0 articles | PMID: 37575153 | PMCID: PMC10415638
Pituitary Adenylate Cyclase-activating Polypeptide (PACAP) -derived Peptide MPAPO Stimulates Adipogenic Differentiation by Regulating the Early Stage of Adipogenesis and ERK Signaling Pathway.
Stem Cell Rev Rep, 19(2):516-530, 16 Sep 2022
Cited by: 0 articles | PMID: 36112309
Adipose mesenchymal stem cells combined with platelet-rich plasma accelerate diabetic wound healing by modulating the Notch pathway.
Stem Cell Res Ther, 12(1):392, 13 Jul 2021
Cited by: 32 articles | PMID: 34256844 | PMCID: PMC8276220
hPER3 promotes adipogenesis via hHSP90AA1-mediated inhibition of Notch1 pathway.
Cell Death Dis, 12(4):301, 19 Mar 2021
Cited by: 5 articles | PMID: 33741899 | PMCID: PMC7979882
Go to all (47) article citations
Similar Articles
To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.
[Effects of gamma-secretase inhibitor N-(3, 5-difluorophenacetyl-L-alanyl)-S-phenylglycine t-butyl ester on proliferation and differentiation of neural stem cells].
Zhonghua Yi Xue Za Zhi, 88(7):480-483, 01 Feb 2008
Cited by: 3 articles | PMID: 18642791
gamma-secretase inhibitor induces adipogenesis of adipose-derived stem cells by regulation of Notch and PPAR-gamma.
Cell Prolif, 43(2):147-156, 01 Apr 2010
Cited by: 42 articles | PMID: 20447060 | PMCID: PMC6496520
Effects of N-[N-(3, 5-difluorophenacetyl-L-alanyl)]-S-phenylglycine t-butyl ester (DAPT) on cell proliferation and apoptosis in Ishikawa endometrial cancer cells.
Hum Cell, 25(1):9-15, 22 Dec 2011
Cited by: 9 articles | PMID: 22189483
Down-regulation of Notch1 by gamma-secretase inhibition contributes to cell growth inhibition and apoptosis in ovarian cancer cells A2780.
Biochem Biophys Res Commun, 393(1):144-149, 01 Feb 2010
Cited by: 42 articles | PMID: 20117093
Funding
Funders who supported this work.